Skip to main content

Table 2 Nucleotide sequences of the primers used in the q-PCR experiments

From: The effects of hyperoxia on microvascular endothelial cell proliferation and production of vaso-active substances

Target mRNA Target protein Forward primer Reverse primer
NOSIII eNOS TGGCTTTCCCTTCCAGTTC AGAGGCGTTTTGCTCCTTC
EDN1 ET-1 TGTGTCTACTTCTGCCACCTG TGGCTAGCACATTGGCATCTA
ACTB Beta-actin AACTCCATCATGAAGTGTGACG GATCCACATCTGCTGGAAGG
  1. NOSIII/eNOS endothelial nitric oxide synthase, EDN1 preproendothelin-1, ET-1 endothelin-1